Stock Number: 003780 Strain Name: B6.Cg-Sgshmps3a/PstJ

Allele: Sgshmps3a Protocol Name: Sgshmps3a Method: Pyrosequencing Version: 3.0 Created: 29-January -2010 Updated: 11-April -2011

Expected Results: WT=C Mut=T

Sequence: CACGCCCTCTGCTCTGTCTTCCTCAGCG(g/a)ATGACGGAGGCTTTGAGAGTGGTGTAT

This genotyping protocol is used for the following strains:   Stock Number Strain Name 003780 B6.Cg-Sgshmps3a/PstJ Genotyping resources and troubleshooting This page contains guidelines, frequently asked questions, and helpful external links to genotyping and PCR resources.