Stock Number:002020
Strain Name:C57BL/6J-ApcMin/J

ApcMin
ApcMinalternate1
End Point Analysis
1.0
21-December -2011 16-July -2012
Expected Results:

Mutant = A/A
Heterozygote = T/A
Wild type = T/T

amplicon = 85 bp

Sequence:

GACATGATGATAGTAGGTCAGACAATTTCAATACTGGAAACATGACTGTTCTTTCACCATATTTAAATACTACGGTATTGCCCAGCTCTTCTTCCTCAAGGGGAAGTTTAGACAGTTCTCGTTCTGAGAAAGACAGAAGTT(t/a)GGAGAGAGAGCGAGGTATTGGCCTCAGTGCTTACCATCCAACAACAGAAAATGCAGGAACCTCATCAAAACGAGGTCTGCAGATCACTACCACTGCAGCCCAGATAGCCAAAGTTATGGAAGAAGTATCAGCCATTCATACCTCCCAGGACGACA

Protocol Primers 
Primer 5' Label Sequence 5' --> 3' 3' Label Primer Type
13779 - GGG AAG TTT AGA CAG TTC TCG T - Forward
13780 - TGT TGG ATG GTA AGC ACT GAG - Reverse
13781 6-FAM AGA CAG AAG TTA GGA GAG AGA GC

Iowa Black

Probe
13782 JOE NHS Ester AGA CAG AAG TTT GGA GAG AGA GC

Iowa Black

Probe
Reaction/Components 
Reaction Component Volume (µl) Final
Concentration
Total Volume (µl)
2 X Kapa Probe Fast QPCR 2.50 1.00 X 2.50
ddH2O 0.07 - 0.07
100 uM 13779 0.02 0.40 uM 0.02
100 uM 13780 0.02 0.40 uM 0.02
100 uM 13781 0.01 0.20 uM 0.01
100 uM 13782 0.01 0.20 uM 0.01
DNA 2.37 - 2.37
Cycling 
Step # Temp °C Time Note
1 95 10min -
2 92 15sec -
3 60 1 min -
4 - - repeat steps 2-3 for 40 cycles
5 4 - Forever
This genotyping protocol is used for the following strains:
 
Stock Number Strain Name
002020 C57BL/6J-ApcMin/J
Genotyping resources and troubleshooting
This page contains guidelines, frequently asked questions, and helpful external links to genotyping and PCR resources.